|
|
2011
Evolution of Feathers
National Geographic, February 2011 LinkSelected for The Best American Science and Nature Writing 2012Most of us will never get to see nature's greatest marvels in person. We won't get a glimpse of a colossal squid's eye, as big as a basketball. The closest we'll get to a narwhal's unicornlike tusk is a photograph. But there is one natural wonder that just about all of us can see, simply by stepping outside: dinosaurs using their feathers to fly. Birds are so common, even in the most paved-over places on Earth, that it's easy to take for granted both their dinosaur heritage and the ingenious plumage that keeps them aloft. To withstand the force of the oncoming air, a flight feather is shaped asymmetrically, the leading edge thin and stiff, the trailing edge long and flexible. To generate lift, a bird has merely to tilt its wings, adjusting the flow of air below and above them. Airplane wings exploit some of the same aerodynamic tricks. But a bird wing is vastly more sophisticated than anything composed of sheet metal and rivets. From a central feather shaft extends a series of slender barbs, each sprouting smaller barbules, like branches from a bough, lined with tiny hooks. When these grasp on to the hooklets of neighboring barbules, they create a structural network that's featherlight but remarkably strong. When a bird preens its feathers to clean them, the barbs effortlessly separate, then slip back into place.
Could information about a lab-made virus really help evildoers create a biological weapon?
Slate, December 23, 2011 LinkHere is one of the scariest things you’ll ever read: atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccact gtggaccatatggccataatcaagaaatThese are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries. On Dec. 19, it claimed its latest victim, a 29-year-old Egyptian man who probably contracted it from the chickens in his backyard. The only consolation for such deaths is that there are not more of them. The virus has proved unable to spread from person to person since it first emerged 14 years ago.
Rise of the e-book
Nature, December 21, 2011 LinkIn the summer of 2010, on a tiny island off the coast of Maine, I saw the future of books. I had been invited to teach a writing course at Shoals Marine Laboratory on Appledore Island, a beautiful bulge of rock covered in scrub and herring-gull nests. During a break at the beach with my family, my wife finished reading her book with typical supersonic speed. She craved another, so decided to experiment with her new iPhone. She tapped the screen. In seconds, an e-book had streamed invisibly through the air into her hand. Swiping her thumb like a windshield wiper, she soon finished it. She tapped the screen for another. Out of the ether, another e-book appeared.
Sewing Audio to Video, and Rubber Hands Onto People
Discover, December 2011 LinkI don’t usually stream Netflix onto my television to probe the inner workings of my mind, but it had that effect not long ago. While I was catching an old episode of Law & Order: Criminal Intent, the actors’ voices lagged a fraction of a second behind the movement of their mouths, making me so disoriented it completely ruined the show. Soon my irritation turned to puzzlement, and some self-observation allowed me to track my frustration to a precise source. I didn’t care that the ominous soundtrack rose half a second late when Vincent D’Onofrio and Kathryn Erbe crept into the subway tunnel where they were about to find a body. I didn’t care that the show’s trademark duh-dung! sound marking a new scene was still duh-dung-ing after the scene started. It was only when people talked that I went batty. I would watch the characters speak, and then I’d switch to listening to them, and then I’d watch them speak again. I just couldn’t meld the two streams of information in my head.
Our Microbiomes, Ourselves
The New York Times (Sunday Review), December 4, 2011 LinkImagine a scientist gently swabs your left nostril with a Q-tip and finds that your nose contains hundreds of species of bacteria. That in itself is no surprise; each of us is home to some 100 trillion microbes. But then she makes an interesting discovery: in your nose is a previously unknown species that produces a powerful new antibiotic. Her university licenses it to a pharmaceutical company; it hits the market and earns hundreds of millions of dollars. Do you deserve a cut of the profits? It is a tricky question, because it defies our traditional notions of property and justice. You were not born with the germ in your nose; at some point in your life, it infected you. On the other hand, that microbe may be able to grow and reproduce only in a human nose. You provided it with an essential shelter. And its antibiotics may help keep you healthy, by killing disease-causing germs that attempt to invade your nose.
Human Nature’s Pathologist (Profiles in Science)
The New York Times, November 29, 2011 LinkCAMBRIDGE, Mass. -- Steven Pinker was a 15-year-old anarchist. He didn’t think people needed a police force to keep the peace. Governments caused the very problems they were supposed to solve. Besides, it was 1969, said Dr. Pinker, who is now a 57-year-old psychologist at Harvard. “If you weren’t an anarchist,” he said, “you couldn’t get a date.” At the dinner table, he argued with his parents about human nature. “They said, ‘What would happen if there were no police?’ ” he recalled. “I said: ‘What would we do? Would we rob banks? Of course not. Police make no difference.’”
Maybe You Do Need A Hole In Your Head -- To Let the Medicine In
Discover, November 2011 LinkNeuroscientists these days regularly make spectacular discoveries about how the brain gets sick. They know much more today about brain cancer, Alzheimer’s disease, Parkinson’s disease, and a host of other neurological disorders than they did just a few years ago. And from such discoveries come all sorts of encouraging possibilities for treating or even curing these diseases. If only we could break down some rogue protein or bind a drug to a troublesome receptor, it seems as if all would be well. There’s just one little hitch: Even if scientists invented the perfect cure, they probably couldn’t get it into the brain to do its work.
Can Answers to Evolution Be Found in Slime?
The New York Times, October 3, 2011 LinkIf you want to find life forms that truly seem otherworldly, your local forest is a much better place than your local cineplex. It is home to creatures that are immensely old, fundamentally bizarre and capable of startlingly sophisticated behavior. They are the slime molds. Slime molds are a remarkable lineage of amoebas that live in soil. While they spend part of their life as ordinary single-celled creatures, they sometimes grow into truly alien forms. Some species gather by the thousands to form multicellular bodies that can crawl. Others develop into gigantic, pulsating networks of protoplasm. While naturalists have known of slime molds for centuries, only now are scientists really starting to understand them. Lab experiments are revealing the complex choreography of signals in some species that allows 20,000 individuals to form a single sluglike body.
The Language Fossils Buried in Every Cell of Your Body
Discover, October 2011 LinkIt is a shame that grammar leaves no fossils behind. Few things have been more important to our evolutionary history than language. Because our ancestors could talk to each other, they became a powerfully cooperative species. In modern society we are so submerged in words--spoken, written, signed, and texted--that they seem inseparable from human identity. And yet we cannot excavate some fossil from an Ethiopian hillside, point to a bone, and declare, “This is where language began.” Lacking hard evidence, scholars of the past speculated broadly about the origin of language. Some claimed that it started out as cries of pain, which gradually crystallized into distinct words. Others traced it back to music, to the imitation of animal grunts, or to birdsong. In 1866 the Linguistic Society of Paris got so exasperated by these unmoored musings that it banned all communication on the origin of language. Its English counterpart felt the same way. In 1873 the president of the Philological Society of London declared that linguists “shall do more by tracing the historical growth of one single work-a-day tongue, than by filling wastepaper baskets with reams of paper covered with speculations on the origin of all tongues.”
Horwich Wins Lasker Award by Straddling Science and Medicine
The New York Times, September 13, 2011 LinkNEW HAVEN -- Medicine is a divided world. On one side are the doctors, who come face to face with illness each day and try to heal their patients with whatever tools they can get their hands on. On the other are the researchers, who explore the body’s microscopic complexity, never sure whether their discoveries will ever end up in the hands of the doctors. Dr. Arthur Horwich, a medical geneticist at Yale University, lives in both worlds. “I’ve always been on the fence between science and medicine,” he said. “I could never make up my mind.” He has spent decades in the company of children, treating them as best he can for potentially fatal disorders. But he has also spent countless hours pondering a microscopic box found in our cells, trying to figure out what happens inside it.
The Wired Atlas of the Human Ecosystem
Wired, September 2011 LinkIf some twisted genius vaporized all 10 trillion cells in your body -- along with the hair, the fingernails, and other tissue they create -- it would not leave empty space behind. A body-shaped cloud made of bacteria, viruses, and other former stowaways would hover briefly in the air. The cloud would outline your skin, delineate your lungs, trace your digestive tract. You might be gone for good, but your shadow biosphere would remain. We got our first glimpse of these tiny tenants -- now known collectively as the microbiome -- in the late 17th century, when a Dutch lens grinder named Anton van Leeuwenhoek noticed a layer of white scum between his teeth. He mixed some of the gunk with pure rainwater and then placed it under one of his handmade microscopes. “I found, to my great surprise,” he wrote, “that it contained many small animalcules, the motions of which were very pleasing to behold.”
How Many Species? A Study Says 8.7 Million, but It’s Tricky.
The New York Times, August 30, 2011 LinkIn the foothills of the Andes Mountains lives a bat the size of a raspberry. In Singapore, there’s a nematode worm that dwells only in the lungs of the changeable lizard. The bat and the worm have something in common: They are both new to science. Each of them recently received its official scientific name: Myotis diminutus for the bat, Rhabdias singaporensis for the worm. These are certainly not the last two species that scientists will ever discover. Each year, researchers report more than 15,000 new species, and their workload shows no sign of letting up. “Ask any taxonomist in a museum, and they’ll tell you they have hundreds of species waiting to be described,” says Camilo Mora, a marine ecologist at the University of Hawaii. Scientists have named and cataloged 1.3 million species. How many more species there are left to discover is a question that has hovered like a cloud over the heads of taxonomists for two centuries.
Climate Relicts: Seeking Clues On How Some Species Survive
Yale Environment 360, August 29, 2011 LinkA two-hour’s drive north of Madrid is an extraordinary sight: forests of beech trees. It’s not the European beech itself that’s extraordinary. After all, Fagus sylvatica grows across a wide swath of the continent. It’s beech trees in central Spain that are strange. To grow, beeches require a moist, relatively cool climate -- a climate that’s almost impossible to find in central Spain. “They’re limited to cool moist valleys in a hot, dry mountain range,” explains Alistair Jump, an ecologist at the University of Stirling who studies the trees. The trees, which lie about 200 miles south of the edge of the main range of European beeches, did not get to central Spain recently, their seeds carried on the shoe of some German tourist. Evidence from both fossils and genes shows that beeches have lived in some parts of Spain since the last Ice Age. At the time, most of Europe was either buried under ice or too harsh a climate for the beeches to survive. But after the Ice Age, suitable habitats opened up, and the beeches expanded from their southern refuges into the north.
Chimpanzees Clear Some Doubt After Generosity Is Questioned
The New York Times, August 9, 2011 LinkWhen it comes to the evolution of humans, a lot depended on the kindness of strangers. Our species is especially cooperative. We routinely help other people -- relatives and strangers alike -- even when there’s no immediate reward for us. The concern that humans have for each other is part of the foundation of complex societies, from neighborhoods to nations.
A Body Fit for a Freaky-Big Brain
Discover, July-August 2011 LinkIn 1758 the Swedish taxonomist Carolus Linnaeus dubbed our species Homo sapiens, Latin for “wise man.” It’s a matter of open debate whether we actually live up to that moniker. If Linnaeus had wanted to stand on more solid ground, he could have instead called us Homo megalencephalus: “man with a giant brain.” Regardless of how wisely we may use our brains, there’s no disputing that they are extraordinarily big. The average human brain weighs in at about three pounds, or 1,350 grams. Our closest living relatives, the chimpanzees, have less than one-third as much brain - just 384 grams. And if you compare the relative size of brains to bodies, our brains are even more impressive.
It’s Science But Not Necessarily Right
The New York Times, June 26, 2011 LinkOne of the great strengths of science is that it can fix its own mistakes. “There are many hypotheses in science which are wrong,” the astrophysicist Carl Sagan once said. “That’s perfectly all right: it’s the aperture to finding out what’s right. Science is a self-correcting process.” If only it were that simple. Scientists can certainly point with pride to many self-corrections, but science is not like an iPhone; it does not instantly auto-correct. As a series of controversies over the past few months have demonstrated, science fixes its mistakes more slowly, more fitfully and with more difficulty than Sagan’s words would suggest. Science runs forward better than it does backward.
The Evolution Right Under Our Noses
The New York Times, July 25, 2011 LinkTo study evolution, Jason Munshi-South has tracked elephants in central Africa and proboscis monkeys in the wilds of Borneo. But for his most recent expedition, he took the A train. Dr. Munshi-South and two graduate students, Paolo Cocco and Stephen Harris, climbed out of the 168th Street station lugging backpacks and a plastic crate full of scales, Ziploc bags, clipboards, rulers and tarps. They walked east to the entrance of Highbridge Park, where they met Ellen Pehek, a senior ecologist in the New York City Parks and Recreation Department. The four researchers entered the park, made their way past a basketball game and turned off the paved path into a ravine.
The Visitors That Came to Stay
(A review of Virolution by Frank Ryan) The Wall Street Journal, June 18, 2011 LinkWe are part virus. This bizarre yet inescapable fact has been revealed over the past 30 years, as scientists have spelunked their way through the human genome and encountered stretches of DNA with the telltale chemical signatures of viruses. All told, they've found 100,000 such segments so far. As Frank Ryan explains in "Virolution," these pieces of virus DNA ended up in our genome through a peculiar kind of infection. From time to time, viruses slipped their DNA into the eggs and sperm of our ancestors. Parents then passed down the virus DNA to their offspring. These viruses could no longer escape their hosts, but they could still make new copies of their DNA, which were then inserted back into our ancestors' genomes. And so it is that, after millions of years of infection, viruses now make up at least 8% of the human genome. Our "own" genes--the genes that encode the proteins that constitute our bodies--make up a measly 1.2%.
Rise of the Superbacteria
Newsweek, June 5, 2011 LinkWhen Philip Tarr heard the first reports of a massive outbreak of E. coli in Europe recently, they had a sickeningly familiar ring. Tarr, a microbiologist at Washington University, is an expert on the strains of E. coli that have periodically wreaked havoc in the United States. In 2006, for example, E. coli on contaminated spinach infected 199 people in the United States, causing kidney failure in a number of cases. The European outbreak seemed to fit the pattern: people were infected with E. coli apparently after eating contaminated vegetables.
A Tiny Key to a Terrible Lock
Discover, June 2011 LinkFor tens of millions of Americans, pain is not just an occasional nuisance - a stubbed toe, a paper cut - but a constant and torturous companion. Chronic pain can be focused on an arthritic knee or a bad back, diffused throughout the body, or even located virtually in an amputated limb. It can linger for years. And it can transform the world so that merely the light brush of a finger is an agonizing experience. The daily devastation can be so intense that people with chronic pain are up to six times as likely as those who are pain-free to report suicidal thoughts. Despite the toll, chronic pain has been relatively neglected by doctors. Perhaps that’s because it seems less real to them than other, more tangible medical disorders. With no equivalent of a stethoscope or thermometer to measure pain objectively, they have had to rely entirely on their patients’ testimony.
The Discovery of Arsenic-Based Twitter
Slate, May 27, 2011 LinkCast your mind back six months, to late November 2010. Wikileaks had unveiled the first goodies from its cache of 250,000 State Department cable. Hosni Mubarak's National Democratic Party was coasting toward yet another easy win in Egyptian elections. And, for just a few days, a lot of us wondered if NASA had discovered aliens. If you've forgotten about that otherworldly dalliance, today is a good time to refresh your memory. On November 29, NASA announced that it would soon hold a press conference to "discuss an astrobiology finding that will impact the search for evidence of extraterrestrial life." Wild speculation ran amok--perhaps scientists had found living things on one of Saturn's moons. At the press conference, the scientists did not unveil an actual extraterrestrial, but they did have big news. A new paper had just been published in the journal Science, they said, which described bacteria that seemed able to build their own DNA from arsenic. If that were true, it would be an historic discovery, because no such ability has ever been found among Earth's life-forms.
Turning to Biomechanics to Build a Kinder, Gentler Rib Spreader
The New York Times, May 16, 2011 LinkDURHAM, N.C.--The sign on the door at the renovated tobacco warehouse reads “Physcient.” Inside are a few rooms that, depending on where you look, seem like an artist’s studio, a machine shop or a natural history museum. A lathe stands next to a drill press; along other walls are vises, huge enamel-red C-clamps, microscopes and plywood frames covered in electronics. But there are also reed-woven sculptures of insects called water boatmen hanging on the walls, along with glass-fronted boxes holding preserved flying dragon lizards. Casts of human rib bones are scattered on tables. A huge cast of a fearsome pair of fish jaws rests on a row of books. Physcient is, in fact, a medical technology company. But its decor speaks to the exceptional careers of its co-founders, Hugh Crenshaw and Charles Pell. They both got their start studying biomechanics -- how creatures fly, swim and crawl. Mr. Pell built models of muscles and fish heads. Dr. Crenshaw earned his Ph.D. figuring out how single-celled creatures swim. And over the past 20 years they’ve profitably translated their understanding of biomechanics into inventions, from robotic submarines to pill sorters.
The Brain is Made of Its Own Architects
Discover, May 2011 LinkIn the 1940s, the Nobel prize-winning neurobiologist Roger Sperry performed some of the most important brain surgeries in the history of science. His patients were newts. Sperry started by gently prying out newts’ eyes with a jeweler’s forceps. He rotated them 180 degrees and then pressed them back into their sockets. The newts had two days to recover before Sperry started the second half of the procedure. He sliced into the roof of each newt’s mouth and made a slit in the sheath surrounding the optic nerve, which relays signals from the eyes to the brain. He drew out the nerve, cut it in two, and tucked the two ragged ends back into their sheath. If Sperry had performed this gruesome surgery on a person, his patient would have been left permanently blind. But newts have a remarkable capacity to regrow nerves. A month later Sperry’s subjects could see again.
A review of First Contact: Scientific Breakthroughs in the Hunt For Life Beyond Earth, by Mark Kaufman
Wall Street Journal, April 23, 2011 LinkThe bottom of a mine shaft doesn't seem like the sort of place a naturalist should go to look for life. But scientists have found thriving communities of microbes living as deep as two miles underground. These organisms can't rely on sunlight for their energy, so they survive instead on the radioactivity of the rocks in which they dwell. They exist in a world separate from our own, an ecological Hades. As Marc Kaufman explains in First Contact, these microbes are important for two reasons: They show the extremes to which life on Earth can go, and they can help us imagine what life might look like on other worlds. Mars, for example, was probably a warm, wet planet in its infancy four billion years ago. But then it lost its heat-trapping atmosphere and became cold and dry. If life took hold early on in Martian history, it might have been able to retreat inside the Red Planet. It might still be there today.
Climate Extinctions
The New York Times, April 5, 2011 LinkOver the past 540 million years, life on Earth has passed through five great mass extinctions. In each of those catastrophes, an estimated 75 percent or more of all species disappeared in a few million years or less. For decades, scientists have warned that humans may be ushering in a sixth mass extinction, and recently a group of scientists at the University of California, Berkeley, tested the hypothesis. They applied new statistical methods to a new generation of fossil databases. As they reported last month in the journal Nature, the current rate of extinctions is far above normal. If endangered species continue to disappear, we will indeed experience a sixth extinction, over just the next few centuries or millennia.
Memories Are Crucial for Looking Into the Future
Discover, April 2011 LinkOne day not long ago a 27-year-old woman was brought to the Tel Aviv Sourasky Medical Center, sleepy and confused. Fani Andelman, a neuropsychologist at the center, and colleagues gave the woman a battery of psychological tests to judge her state of mind. At first the woman seemed fine. She could see and speak clearly. She could understand the meaning of words and recall the faces of famous people. She could even solve logic puzzles, including a complex test that required her to plan several steps ahead. But her memory had holes. She could still remember recent events outside her own life, and she could tell Andelman details of her life up to 2004. Beyond that point, however, her autobiography was in tatters. The more doctors probed her so-called episodic memory--the sequential recollection of personal events from the past--the more upset she became. As for envisioning her personal future, that was a lost cause. Asked what she thought she might be doing anytime beyond the next day, she couldn’t tell them anything at all. The patient, Andelman realized, hadn’t just lost her past; she had lost her future as well. It was impossible for her to imagine traveling forward in time. During her examination, the woman offered an explanation for her absence of foresight. “I barely know where I am,” she said. “I don’t picture myself in the future. I don’t know what I’ll do when I get home. You need a base to build the future.”
From Single Cells, a Vast Kingdom Arose
The New York Times, March 14, 2011 LinkLurking in the blood of tropical snails is a single-celled creature called Capsaspora owczarzaki. This tentacled, amoebalike species is so obscure that no one even noticed it until 2002. And yet, in just a few years it has moved from anonymity to the scientific spotlight. It turns out to be one of the closest relatives to animals. As improbable as it might seem, our ancestors a billion years ago probably were a lot like Capsaspora.
The Trouble With Teens
Discover, March 2011 LinkTeenagers are a puzzle, and not just to their parents. When kids pass from childhood to adolescence their mortality rate doubles, despite the fact that teenagers are stronger and faster than children as well as more resistant to disease. Parents and scientists alike abound with explanations. It is tempting to put it down to plain stupidity: Teenagers have not yet learned how to make good choices. But that is simply not true. Psychologists have found that teenagers are about as adept as adults at recognizing the risks of dangerous behavior. Something else is at work.
In a Marine Worm’s Eyes, the Theory of Evolution
The New York Times, March 1, 2011 LinkCharles Darwin considered the evolution of the human eye one of the toughest problems his theory had to explain. In “On the Origin of Species,” he wrote that the idea that natural selection could produce such an intricate organ “seems, I freely confess, absurd in the highest possible degree.” But Darwin dispelled that seeming absurdity by laying out a series of steps by which the evolution could take place. Making this sequence all the more plausible was the fact that some of the transitional forms Darwin described actually existed in living invertebrates.
Alien Species Reconsidered:Finding a Value in Non-Natives
Yale Environment 360, Feburary 24, 2011 LinkThe tale of the honeybee is a sadly familiar one: a once-thriving species is on the ropes. After brutal bouts with mites and fungi, honeybees are now facing their most dangerous threat yet: a mysterious disease called colony collapse disorder. In the winter of 2010 alone, U.S. beekeepers reported losing 34 percent of their hives to CCD, which may be caused by viruses, pesticides, or some diabolical combination of factors. Researchers are working hard to figure out exactly why the honeybees are dying and how to save them because of their ecological importance. Honeybees pollinate many of the country’s fruit and vegetable crops, and they also carry out the same service for many species of wild plants. In Brazil, honeybees help keep isolated rain forest fragments from dying out by moving their pollen from tree to tree.
Fleas’ ‘Feet’ Unleash That Spectacular Leap
The New York Times, February 10, 2011 LinkOne moment, the 10 fleas were happily sucking blood from hedgehogs being treated at Tiggywinkles Wildlife Hospital in Aylesbury, which, of course, is in England. The next, they were being plucked from their comfortable home and transported to Cambridge, where they ended up in a glass box with a Styrofoam floor. From time to time, bright lights would flood the box, so that a high-speed camera could film them. And the fleas did what fleas do in times of crisis: they jumped.
Nonfiction: Nabokov Theory on Butterfly Evolution Is Vindicated
The New York Times, February 1, 2011 LinkVladimir Nabokov may be known to most people as the author of classic novels like “Lolita” and “Pale Fire.” But even as he was writing those books, Nabokov had a parallel existence as a self-taught expert on butterflies.
100 Trillion Connections
Scientific American, January 2011 LinkA single neuron sits in a Petri dish, crackling in lonely contentment. From time to time, it spontaneously unleashes a wave of electric current that travels down its length. If you deliver pulses of electricity to one end of the cell, the neuron may respond with extra spikes of voltage. Bathe the neuron in various neurotransmitters, and you can alter the strength and timing of its electrical waves. On its own, in its dish, the neuron can’t do much. But join together 302 neurons, and they become a nervous system that can keep the worm Caenorhabditis elegans alive--sensing the animal’s surroundings, making decisions and issuing commands to the worm’s body. Join together 100 billion neurons--with 100 trillion connections--and you have yourself a human brain, capable of much, much more. How our minds emerge from our flock of neurons remains deeply mysterious. It’s the kind of question that neuroscience, for all its triumphs, has been ill equipped to answer. Some neuroscientists dedicate their careers to the workings of individual neurons. Others choose a higher scale: they might, for example, look at how the hippocampus, a cluster of millions of neurons, encodes memories. Others might look at the brain at an even higher scale, observing all the regions that become active when we perform a particular task, such as reading or feeling fear. But few have tried to contemplate the brain on its many scales at once. Their reticence stems, in part, from the sheer scope of the challenge. The interactions between just a few neurons can be a confusing thicket of feedbacks. Add 100 billion more neurons to the problem, and the endeavor turns into a cosmic headache. Read more
Richard Panek's study of the cosmos, "The 4 Percent Universe" (Book review)
The Washington Post, January 28, 2011 LinkIn 1969, an astronomer named Jeremiah Ostriker realized that the Milky Way was spinning too fast. That may sound odd, given that it takes the sun 230 million years to make a full orbit. But when Ostriker tried to simulate the Milky Way on a computer, he found that it was spinning so quickly that it should have ripped itself apart long ago. There weren't enough stars to hold it together.
Canine Tumor Fuels Up by Stealing Parts From Host, Report Says
The New York Times, January 25, 2011 LinkWhen humans domesticated dogs at least 10,000 years ago, an apparent side effect was a bizarre new kind of parasite. A canine cancer gained the ability to spread from one dog to the next, creating new tumors along the way. Today, it thrives in dog populations around the world. Scientists are now studying canine transmissible venereal tumors (or C.T.V.T.) to uncover the adaptations the disease uses to thrive in its peculiar way. In the current issue of Science, British scientists report that it upgrades its energy supply by stealing new parts from its canine hosts.
More to a Smile Than Lips and Teeth
The New York Times, January 24, 2011 LinkIn the middle of a phone call four years ago, Paula Niedenthal began to wonder what it really means to smile. The call came from a Russian reporter, who was interviewing Dr. Niedenthal about her research on facial expressions.
Seeing the Person Behind the Face
Discover, January-February 2011 LinkImagine that an eccentric psychologist accosts you. In his hand is a piece of paper with 20 pictures of roses. One of the pictures shows a rose in the flower bed you just passed, he says, and he asks you to pick its picture out from his lineup. The challenge would seem absurd--but if you were to change the roses to faces, nearly everyone could meet it.
|
 |
|